In order to avoid influencing your own opinion, I have decided not to include the impressive contradictions regarding the highly questionable physiological (nutritional regulation) and pathophysiological (e.g., NAFLD/NASH, diabetes mellitus type 2, viral hepatitis and hepatocarcinoma) role of SREBP1c in hepatic lipid metabolism in front.
But certainly, a careful examination of the articles listed below will clearly state these obscurities.
Before the literature analysis, the following assumption has to be taken into account:
SREBP1c only acts as a „watchdog” for, or rather as a repressor of, SREBP1a in liver. Or even the induction of SREBP1c is only a side effect of the activation (induced transcription, proteolytic activation, increased protein stability and transcriptional activity) of SREBP1a.
In conclusion:
Instead of SREBP1c, SREBP1a (de)regulates hepatic lipid homeostasis.
(Additional information is marked in red colour)
The decisive factor influencing the rate of hepatic de novo lipogenesis is the feeding regime of the model organism (fasted, non-fasted and refed or preprandial and postprandial). With respect to the ratio of SREBP1a to SREBP1c and the pathophysiological role of SREBP1a, the feeding regime or nutritional status may be of significant importance; see ref. 25 (figure 8B) and ref. 30 - 32.
1: Shimano et al. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest. 1996 Oct 1;98(7):1575-84. [Also compare the liver tiglyceride content of SREBP1a transgenic mice line G with that of SREBP1c transgenic mice (see ref. 2)]
2: Shimano et al. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest. 1997 Mar 1;99(5):846-54. [Endogenous levels of nuclear isoform 1c do not induce, rather suppress, endogenous SREBP1 mRNA (autoregulatory feed-forward loop?). In contrast, nuclear isoform 1a clearly induces endogenous SREBP1 mRNA; also see ref. 1 and 10. Additionally, supraphysiological levels of 1c are needed to achieve 1a-comparative effects]
3: Liang et al. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c. J Biol Chem. 2002 Mar 15;277(11):9520-8. [»In wild-type mice, fasting lowered all of the mRNAs for the fatty acid and triglyceride-synthesizing enzymes, and refeeding raised the levels to supernormal values. Surprisingly, some of these mRNAs appeared to rise to nearly normal values in the refed SREBP-1c knockout mice.«]
5: Moon et al. The Scap/SREBP pathway is essential for developing diabetic fatty liver and carbohydrate-induced hypertriglyceridemia in animals. Cell Metab. 2012 Feb 8;15(2):240-6. [»Unexpectedly, inactivation of the Srebp-1c isoform in ob/ob mice reduced hepatic FA synthesis and TG content by only 50%.«. SREBP1c knockout mice only express ~2/3 of SREBP1a (and SCAP) compared to wild type; see ref. 3]
6a: Zhao et al. Inhibition of SREBP transcriptional activity by a boron-containing compound improves lipid homeostasis in diet-induced obesity. Diabetes. 2014 Jul;63(7):2464-73. [Basically, BF175 is SREBP1a-specific; see ref. 6b]
7: Frederico et al. Short-term inhibition of SREBP-1c expression reverses diet-induced non-alcoholic fatty liver disease in mice. Scand J Gastroenterol. 2011 Nov;46(11):1381-8. [For inhibition of SREBP1c expression the authors used a SREBP1a isoform-specific antisense oligonucleotide; see ref. 8 (figure 1B)]
12: Zhang et al. A simple promoter containing two Sp1 sites controls the expression of sterol-regulatory-element-binding protein 1a (SREBP-1a). Biochem J. 2005 Feb 15;386(Pt 1):161-8. [In addition to the other molecular mechanims (proteolytic activation, increased protein stability and transcriptional activity), also the transcription of SREBP1a is under nutritional regulation; also see ref. 13, 14 (and 15)]
16: Bitter et al. Pregnane X receptor activation and silencing promote steatosis of human hepatic cells by distinct lipogenic mechanisms. Arch Toxicol. 2015 Nov;89(11):2089-103. [The expression of SREBP1a and a battery of SREBP1-regulated genes was shown here for the first time to be consistently up-regulated in non-alcoholic steatohepatitis (NASH); also see ref. 17. Additionally, two other groups specifically measured SREBP1a in NAFLD (see ref. 18 and 19), apparently without noticing, thereby confirming the results of ref. 16 and 17]
17: Bitter et al. Human sterol regulatory element-binding protein 1a contributes significantly to hepatic lipogenic gene expression. Cell Physiol Biochem. 2015;35(2):803-15. [Endogenous SREBP1a and 1c mature proteins were identified separately and measured reliably for the first time. However, the author(s) of a "review" (see here) doubts whether the SREBP1 isoforms were exactly identified]
20: Tong et al. E4BP4 is an insulin-induced stabilizer of nuclear SREBP-1c and promotes SREBP-1c-mediated lipogenesis. J Lipid Res. 2016 Jul;57(7):1219-30. [To cite just one of many examples with respect to "What about SREBP1a". For knock-down experiments the authors used a plasmid targeting GTCTTCTATCAATGACAAGA, which is common to 1c and 1a transcripts. Further examples: ref. 21, 22, 23, 26 and 29]
21: Li et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011 Apr 6;13(4):376-88. [SREBP1a represents the major SREBP1 protein isoform in HepG2; see ref. 16]
24: Amemiya-Kudo et al. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes. J Lipid Res. 2002 Aug;43(8):1220-35. [»...showing relatively high affinity and low saturation kinetics between a classic SRE and SREBPs.« and » In contrast, SREBP-1c was 10-fold weaker and essentially inactive.«]
25: Horton et al. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest. 1998 Jun 1;101(11):2331-9. [»...SREBP-1c livers were generally indistinguishable from wild-type.« and »Transgenic SREBP-1c mice were not fasted.«]
26: Ponugoti et al. SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism. J Biol Chem. 2010 Oct 29;285(44):33959-70. [Once again, "What about SREBP1a": see ref. 27 and 28]
30: Im et al. Sterol regulatory element binding protein 1a regulates hepatic fatty acid partitioning by activating acetyl coenzyme A carboxylase 2. Mol Cell Biol. 2009 Sep;29(17):4864-72. [The results of this study are in contradiction with the findings of Frederico et al. (see ref. 7). However, in the fasted state, hepatic triglyceride stores were lower in SREBP1a-deficient mice compared to wild type. Fasting reduces the amount of the 1c transcript dramatically, which leads to the fact that the ratio of 1a to 1c significantly rises. This may suggest that under fasting conditions (preprandial) SREBP1a-dependent (de)regulation of hepatic de novo lipogenesis is of high importance, which should be considered in regard to the pathophysiology of NAFLD/NASH and T2D; see ref. 25 (figure 8B), 31 (figure 2B and C) and 32 (figure 2). Furthermore, Im et al. reported that 1a-deficient mice are protected from hepatic steatosis on high sucrose diet; see here]
31: Donnelly et al. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J Clin Invest. 2005 May;115(5):1343-51. [1) »...our NAFLD patients exhibited elevated fasting DNL (26%) and failed to appropriately increase lipogenesis postprandially...«, 2) »...stimulation of lipogenesis in healthy subjects after consumption of a meal, rising from less than 5% to a peak of 23%...« (see ref. 32) and 3) »The lack of postprandial stimulation suggests the liver’s lipogenic potential may be reaching a threshold in these patients.«]
33: Libby et al. Perilipin-2 Deletion Impairs Hepatic Lipid Accumulation by Interfering with SREBP Activation and Altering the Hepatic Lipidome. J Biol Chem. 2016 Sep 27. pii: jbc.M116.759795. [The results presented in figure 3A and B strongly suggest elevation of SREBP1a by Western diet. If PUFAs down-regulate SREBP1a, SREBP1a may be one of the most important transcription factors influencing the rate of hepatic de novo lipogenesis in NAFLD/NASH and T2D; see ref. 34, 35, 36, 38 and 39]
34: Hannah et al. Unsaturated fatty acids down-regulate srebp isoforms 1a and 1c by two mechanisms in HEK-293 cells. J Biol Chem. 2001 Feb 9;276(6):4365-72. [SREBP1a represents the major SREBP1 isoform in HEK-293]
36: Takeuchi et al. Polyunsaturated fatty acids selectively suppress sterol regulatory element-binding protein-1 through proteolytic processing and autoloop regulatory circuit. J Biol Chem. 2010 Apr 9;285(15):11681-91. [»This study has clearly demonstrated that the primary mechanism of the inhibitory effect of PUFA is the suppression of the proteolytic activation of SREBP-1 and that the transcriptional regulation is secondary to this post-translational suppression of mature SREBP-1 that itself binds to the SRE site on the Srebf1c promoter...«. 1c-dependent? See ref. 2 and 37 (figure 1B)]
37: Knebel et al. Liver-specific expression of transcriptionally active SREBP-1c is associated with fatty liver and increased visceral fat mass. PLoS One. 2012;7(2):e31812. [The content of PUFAs...]
One important question remains:
Which factor (or combination of factors) is responsible for the elevated (preprandial) de novo lipogenesis in NAFLD/NASH patients?
Finally, the factor must have properties comparable to insulin and delivers the same performance, for example the activation (induced transcription and translation, proteolytic activation, increased protein stability and transcriptional activity) of SREBP1a.
Last but not least there is reason to assume that the lower expression of SREBP1a is compensated by:
1) Its stronger transcriptional activity [»When SREBP target promoters are analyzed for activation by cotransfected SREBP expression vectors, SREBP-1a is more than 10- to 100-fold more active than SREBP-1c on a per molecule basis when transfected at limiting levels.« (see ref. 30)]
2) Its indispensable necessity in terms of a transcriptional active dimer of SREBP1 [see here; and this article is a must-read]
3) Its more effective proteolytic processing or nuclear translocation [see here (figure 7B - This figure might also be interesting for the author(s) of the "review" mentioned after ref. 17)]